Query (optional)   in Class  

GrainGenes Marker Report: SukEM59

[ Printable Version ]  [ Submit comment/correction ]

Probe
SukEM59
Locus
SukEM49j
[ Show all 26 ]
Reference
ReferenceLeigh F et al. (2003) Comparison of the utility of barley retrotransposon families for genetic analysis by molecular marker techniques Molecular Genetics and Genomics 269:464-474.
Remarks
Position of retroposon-based primer in the LTR = 5' and 6 nucleotides internal to the LTR terminus
MseI primer (KeyGene code) = CTA (M59)
Type
PCR
STS
PCR primers
Sukkula-E0228 5' GGAACGTCGGCATCGGGCTG 3'
Mse1 primer M59 5' GATGAGTCCTGAGTAACTA 3'
Amplification Conditions
amplified as Vos et al Nucl Acids Res 23: 4407-4418
Source Species
Hordeum vulgare



Locus for Probe
SukEM49a
Type
SSAP
Chromosome
6H
Map
Hordeum-SxM-SSAP-6H100.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49b
Type
SSAP
Chromosome
4H
Map
Hordeum-SxM-SSAP-4H28.1
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49c
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H38.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49d
Type
SSAP
Chromosome
6H
Map
Hordeum-SxM-SSAP-6H55.6
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49e
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H84.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49f
Type
SSAP
Chromosome
6H
Map
Hordeum-SxM-SSAP-6H87.4
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49g
Type
SSAP
Chromosome
5H
Map
Hordeum-SxM-SSAP-5H165.6
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49h
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H69.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49i
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H37.4
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49j
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H63
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM49k
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H0
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59a
Type
SSAP
Chromosome
4H
Map
Hordeum-SxM-SSAP-4H59.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59b
Type
SSAP
Chromosome
4H
Map
Hordeum-SxM-SSAP-4H73.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59c
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H135.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59d
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H74.2
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59e
Type
SSAP
Chromosome
3H
Map
Hordeum-SxM-SSAP-3H116.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59f
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H49.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59g
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H84.3
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59h
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H76
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59i
Type
SSAP
Chromosome
5H
Map
Hordeum-SxM-SSAP-5H193.6
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59j
Type
SSAP
Chromosome
6H
Map
Hordeum-SxM-SSAP-6H60.4
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59k
Type
SSAP
Chromosome
2H
Map
Hordeum-SxM-SSAP-2H74.8
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59l
Type
SSAP
Chromosome
6H
Map
Hordeum-SxM-SSAP-6H59.7
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59m
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H65.2
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59n
Type
SSAP
Chromosome
7H
Map
Hordeum-SxM-SSAP-7H124.9
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.



Locus for Probe
SukEM59o
Type
SSAP
Chromosome
1H
Map
Hordeum-SxM-SSAP-1H133.5
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SSAP
Probe
SukEM59
Reference
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.