Query (optional)   in Class  

GrainGenes Marker Report: T4/PSP2152R

[ Printable Version ]  [ Submit comment/correction ]

Probe
T4/PSP2152R
Locus
Xpsr2152.1-2D
Xpsr2152.2-3B
Xpsr2152.2-5D
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.
Type
PCR
STS
PCR primers
T4 5' CCTAAACCCTAAACCCTAGAC
PSP2152R 5' CCTGGTATGTTTCGTGCACTAT
Source Species
Triticum aestivum



Locus for Probe
Xpsr2152.1-2D
Type
Telomere
Chromosome
2D
Chromosome Arm
2DS
Map
Ta-Gale-2D-65
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
T4/PSP2152R
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.



Locus for Probe
Xpsr2152.2-3B
Type
Telomere
Chromosome
3B
Chromosome Arm
3BS
Map
Ta-Gale-3B-58
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
T4/PSP2152R
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.



Locus for Probe
Xpsr2152.2-5D
Type
Telomere
Chromosome
5D
Chromosome Arm
5DS
Map
Ta-Gale-5D-40
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
T4/PSP2152R
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.