Query (optional)   in Class  

GrainGenes Marker Report: T4/PSP2530R

[ Printable Version ]  [ Submit comment/correction ]

Probe
T4/PSP2530R
Locus
Xpsp2530.1-1B
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.
Type
PCR
STS
PCR primers
T4 5' CCTAAACCCTAAACCCTAGAC
PSP2530R 5' TTCTCACCCAACCACCAGCAGCT
Source Species
Triticum aestivum



Locus for Probe
Xpsp2530.1-1B
Type
Telomere
Chromosome
1B
Chromosome Arm
1BS
Map
Ta-Gale-1B-50
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
T4/PSP2530R
Reference
ReferenceMao L et al. (1997) Cloning and genetic mapping of wheat telomere-associated sequences Molecular and General Genetics 254:584-591.