Query (optional)   in Class  

GrainGenes Marker Report: TaCMD

[ Printable Version ]  [ Submit comment/correction ]

Locus
TaCMD
Type
Microsatellite
Chromosome
4H
Map
Barley, B73xCPI-4H105.1
Barley-consensus-2003-4H63
Hordeum-Consensus2006-DArT-4H115.6
[ Show Nearby Loci ]
Map Data
Barley consensus 2003
Barley, B73xCPI
Barley, Consensus 2006, DArT
Probe
TaCMD
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferencePillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Data Source
Langridge, Peter J.
Remark
Assigned to a barley chromosome by PCR screening of wheat barley addition lines
Number of populations contributing to the placement of TaCMD in the Barley, Consensus 2006 DArT maps = 1



Probe
TaCMD
Locus
TaCMD
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferencePillen K et al. (2000) Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars Theoretical and Applied Genetics 101:652-660.
Remarks
Insert contains repeat (gcc)4
Type
SSR
PCR primers
CGTCATGGTCTCCGTCTTCG
ACTTGGCGAGGTATGGCTGC
Forward CGTCATGGTCTCCGTCTTCG
Reverse ACTTGGCGAGGTATGGCTGC
Left 5' CGTCATGGTCTCCGTCTTCG
Right 5' ACTTGGCGAGGTATGGCTGC
SSR size
209
Amplification Conditions
Low Stringency: 35 cycles of 1 min at 94 deg C; 1 min at 50 deg C; 2 min at 72 deg C; and a final extension step of 5 min at 72 deg C
Sequence
X13198
Data Source
Pillen, Klaus01.05