Query (optional)   in Class  

GrainGenes Marker Report: TaGW2-6A

[ Printable Version ]  [ Submit comment/correction ]

Gene
TaGW2-6A (Triticum)
Synonym
SynonymTaGW2-A1 (Triticum)
Gene Class
Thousand-grain weight
Locus
TaGW2-6A
Reference
ReferenceQin L et al. (2017) TaGW2, a Good Reflection of Wheat Polyploidization and Evolution. frontiers in Plant Science 8:318.
[ Show all 16 ]
Gene Product
E3 RING-type ubiquitin ligase
Chromosome
6A
Chromosome Arm
6AS
Comment
Based on its OsGW2 orthologue in rice this gene was characterized and mapped as a CAPS marker in wheat. SNPS in the promoter region allowed distinction of two haplotypes. Hap-6A-A was mainly present in southern Chinese wheats; Hap-6A-G was present in varieties from central and eastern Europe. On average, Hap-6A-A had thousand grain weights more than 3g higher than Hap-6A-G (from KOMUGI Catalogue of Gene Symbols)
Sequence
JN896622.1
KY264770
Wheat Gene Catalog Reference
10781
ReferenceSu Z et al. (2011) Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 122:211-223.



Locus
TaGW2-6A
Chromosome
6A
Chromosome Arm
6AS
Map
Wheat, Xiaoyan 54 x Jing 411_6A3.9
[ Show Nearby Loci ]
Map Data
Wheat, Xiaoyan 54 x Jing 411_6A
2 Point Data
TaGW2-6A/Xcfd80Distance: 0.6 cM
Species
Triticum aestivum
Probe
G2373A
ReferenceSimmonds J et al. (2016) A splice acceptor site mutation in TaGW2-A1 increases thousand grain weight in tetraploid and hexaploid wheat through wider and longer grains. Theoretical and Applied Genetics 129:1099-112.
Hap-6A-P1
ReferenceSu Z et al. (2011) Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 122:211-223.
Hap-6A-P2
ReferenceSu Z et al. (2011) Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 122:211-223.
Associated Gene
TaGW2-6A (Triticum)
Gene Class
Thousand-grain weight
Reference
ReferenceYang Z et al. (2012) SNP identification and allelic-specific PCR markers development for TaGW2, a gene linked to wheat kernel weight. Theoretical and Applied Genetics 125:1057-68.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.



Probe for Locus
Hap-6A-P2
Locus
TaGW2-6A
Related Probe
Hap-6A-P1
Reference
ReferenceSu Z et al. (2011) Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 122:211-223.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.
Type
CAPS
PCR primers
5' F: GAGAAAGGGCTGGTGCTATGGA 3'
5' R: GTAACGCTTGATAAACATAGGTAAT 3'
Specificity
A genome specific primer for TaGW2-6A promoter region. Digestion with TaqI restriction enzyme of PCR product results in 167bp and 218bp restriction fragments for Hap-6A-A and Hap-6A-G haplotypes, respectively.



Probe for Locus
G2373A
Locus
TaGW2-6A
Reference
ReferenceSimmonds J et al. (2016) A splice acceptor site mutation in TaGW2-A1 increases thousand grain weight in tetraploid and hexaploid wheat through wider and longer grains. Theoretical and Applied Genetics 129:1099-112.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Yield. Thousand Grain Weight - Grain Size. TaGW2-A1 MAS Wheat. Marker Assisted Selection in Wheat.
Type
KASP
PCR primers
F_TaGW2-6A 5'-AGA GCA ATT TGT AAG TCT TAT TCC -3'
R_TaGW2-6A_Mutant 5'-GCT TCA ATG ACT TTC TGT TCT TCT-3'
F_TaGW2-6A 5'-AGA GCA ATT TGT AAG TCT TAT TCC -3'
R_TaGW2-6A_Wildtype 5'-GCT TCA ATG ACT TTC TGT TCT TCC-3'
Amplification Conditions
Hotstart at 95C for 15 min Touchdown (10 cycles): 95C, 20 sec; 65C, -1C per cycle, 25 sec; 72C, 45 sec. Amplification (26 cycles): 95C, 10 sec; 57C, 60 sec
Specificity
G2373A SNP [G/A] transition in splice acceptor site of exon 5 of TaGW2-6A identified in TILLING mutant lines. A-type mutation results in frame-shift generating a premature termination codon yielding a shorter protein of 134 amino acids. Lines possessing this mutation showed increased thousand grain weight (TKW) and grain width (GW). Reverse primers are for wild type and mutant type, respectively.
Sequence
KP749902



Probe
Hap-6A-P1
Locus
TaGW2-6A
Related Probe
Hap-6A-P2
Reference
ReferenceSu Z et al. (2011) Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 122:211-223.
ReferenceMAS Wheat. Functional Markers for genes affecting agronomic traits in wheat MAS Wheat. Marker Assisted Selection in Wheat.
Type
CAPS
PCR primers
5' F: CGTTACCTCTGGTTTGGGTGTCGTG 3'
5' R: CACCTCTCGAAAATCTTCCCAATTA 3'
Specificity
A genome specific primer for TaGW2-6A promoter region