Query (optional)   in Class  

GrainGenes Marker Report: U19

[ Printable Version ]  [ Submit comment/correction ]

Locus
U19
Type
RFLP
Chromosome
4H
Chromosome Arm
4HL
Map
Barley-Consensus-4H42.2
Barley-Consensus2-4H94.5
Hordeum-Bins-4H94
[ Show Nearby Loci ]
Map Data
Barley consensus
Barley consensus 2
Barley, BinMap 2005
Probe
MWG2180
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin



Probe for Locus
MWG2180
Locus
U19
MWG2180
HD001H18
Xmwg2180
Type
Genomic
STS
STS primers
5' TGGCAACGAAGACAGAAGG
5' GACTTTCTGCGGAGCAAATC
STS size
172
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234821
MWG2180-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas96.07.10
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03