Query (optional)   in Class  

GrainGenes Marker Report: Xabc152.1

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc152.1
Type
RFLP
Chromosome
1A
Chromosome Arm
1AL
Map
Tm-Dubcovsky-1A3.4
TmTa-Dubcovsky-1A10.6
[ Show Nearby Loci ]
Map Data
T. monococcum, G1777 x G2528
Triticum, CS-G1777 DS1A^m^(1A) RSL
Probe
ABC152
Possible Orthologs
ABC152
[ Show all 14 ]



Probe for Locus
ABC152
Locus
ABC152B
[ Show all 27 ]
Synonym
SynonymHAR35_41484
HAR35_43775
HAR35_47053
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
TCC GCA AGT ACC AGA AGA GC
GAC AAG GAA AGC CAA TCA AC
STS primers
5' AGTCGGCGCCGACCACCGGCGG
5' AGTCGGCGCCGACCACCGGCGG
STS size
ca. 300
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AF309354
L43923
ABC152
ABC152-5
ABC152-3
Linkage Group
6S, Group 5, 2
2
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.5
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Hayes, Patrick M.
Data Source
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03