Query (optional)   in Class  

GrainGenes Marker Report: Xabc156b

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc156b
Type
RFLP
Chromosome
1D
Map
Wheat-Composite2004-1D27
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
ABC156
Possible Orthologs
ABC156
[ Show all 23 ]



Probe for Locus
ABC156
Locus
Sr33
[ Show all 25 ]
Synonym
SynonymHAR35_37808
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
STS primers
5' TTACGGGATCAAAGCTGAGGC
5' GACAAGCAACACCAACCAAGC
STS size
197
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
BQ548054
ABC156
ABC156-5
Polymorphism
ABC156 XbaI
ABC156 EcoRI
ABC156 EcoRV
ABC156 HindIII
ABC156 DraI
Linkage Group
Groups 2,3,1
2
3
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Hayes, Patrick M.
Image
ABC156 SO autoradiogram
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03