Query (optional)   in Class  

GrainGenes Marker Report: Xabc160

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc160
Type
RFLP
Chromosome
1A
1R
Chromosome Arm
1AL
1RS
Map
Rye-2009-Consensus-1R45.7
Secale-UxE-132.3
Ta-Physical-Gill-1D1.56
Tm-Dubcovsky2-1A10
TmTa-Dubcovsky-1A10.6
[ Show Nearby Loci ]
Breakpoint Interval
1DL-6/1DL-8
Map Data
Rye, UC90 x E-line
Rye_2009_consensus
T. monococcum, DV92 x G3116
Triticum, CS-G1777 DS1A^m^(1A) RSL
Wheat, Physical
Probe
ABC160
Possible Orthologs
ABC160
[ Show all 6 ]



Probe for Locus
ABC160
Locus
ABC160
[ Show all 11 ]
Synonym
SynonymHAR35_23388
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GCCAGCGCTCCGGTCTGGTC
AACAAGGCCGCATGGATGTA
Sequence
L43929
ABC160
ABC160-5
Linkage Group
Group 5
Source Species
Hordeum vulgare
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24
ATMI92.09