Query (optional)   in Class  

GrainGenes Marker Report: Xabc160-1

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc160-1
Type
RFLP
Chromosome Arm
1L
Map
Triticeae-Sorrells-161
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
ABC160
Possible Orthologs
ABC160
[ Show all 6 ]



Probe for Locus
ABC160
Locus
ABC160
[ Show all 11 ]
Synonym
SynonymHAR35_23388
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GCCAGCGCTCCGGTCTGGTC
AACAAGGCCGCATGGATGTA
Sequence
L43929
ABC160
ABC160-5
Linkage Group
Group 5
Source Species
Hordeum vulgare
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24
ATMI92.09