Query (optional)   in Class  

GrainGenes Marker Report: Xabc163-6A

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc163-6A
Type
RFLP
Map
Tturgidum-Du-6A9
[ Show Nearby Loci ]
Map Data
T. turgidum, durum x dicoccoides
Probe
ABC163
Possible Orthologs
ABC163
ABC163A
ABC163B
Xabc163



Probe for Locus
ABC163
Locus
ABC163B
[ Show all 7 ]
Synonym
SynonymHAR35_15282
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
STS primers
5' TTACGGGATCAAAGCTGAGGC
5' TGGCAGCGCTGTTGTAGGTT
STS size
252
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BQ548055
ABC163-5
Linkage Group
Group 6
Source Species
Hordeum vulgare
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03