Query (optional)   in Class  

GrainGenes Marker Report: Yr10

Locus
Yr10
Type
Trait
Synonym
Correct nameXrgaYr10-1D
Chromosome
1B
Chromosome Arm
1BS
Map
Wheat, Yr genes and QTL 1B0
Wheat-Composite2004-1B0
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
2 Point Data
Rg1/Yr10#1Distance: 2 cM
Yr10/Gli-B1#1Distance: 5 cM
Yr10/Glu-B1#1Distance: 47 cM
Species
Triticum aestivum
Probe
PSP3000
Associated Gene
Yr10 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xpsp3000-1B
Nearby marker on Composite map: Xpsp3000
Position on Composite map estimated by GrainGenes.



Probe for Locus
PSP3000
Locus
Xpsp3000-1B
Xpsp3000-1B (Gli B1)
Yr10
Xpsp3000
Reference
ReferenceStephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
ReferenceBryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
Type
PCR
SSR
PCR primers
Forward GCAGACCTGTGTCATTGGTC
Reverse GATATAGTGGCAGCAGGATACG
SSR size
286, 1B locus
Amplification Conditions
55C anneal
Source Species
Triticum aestivum
Data Source
Stephenson, Pauline2006.04



Gene Associated with Locus
Yr10 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
XrgaYr10-1D
Yr10
Reference
ReferenceMacer RCF (1975) Plant pathology in a changing world. Transactions of the British Mycological Society 65:351-374.
Chromosome
1B
Chromosome Arm
1BS
ReferenceMetzger RJ and Silbaugh BA (1970) Inheritance of resistance to stripe rust and its association with brown glume colour in Triticum aestivum L. PI 178383. Crop Science 10:567-568.
Germplasm
Hexaploid stockMORO
ReferenceMacer RCF (1975) Plant pathology in a changing world. Transactions of the British Mycological Society 65:351-374.
PI178383
ReferenceMacer RCF (1975) Plant pathology in a changing world. Transactions of the British Mycological Society 65:351-374.
Comment
Hexaploid stock: T. spelta 415 (459).
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24