Query (optional)   in Class  

GrainGenes Marker Report: Yr15

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr15
Type
Gene
Trait
Chromosome
1B
Chromosome Arm
1BS
Map
Triticum-Genes-1B-12.7
Wheat, Yr genes and QTL 1B30.1
Wheat-Composite2004-1B38
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat, Yr genes and QTL
2 Point Data
Yr15/Xcdo1173
Yr15/Xgwm264
Yr15/Xgwm273
Yr15/Xgwm413
Yr15/Xtri
Species
Triticum aestivum
Probe
WMS413
Associated Gene
Yr15 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceCheng P et al. (2014) Molecular mapping of genes Yr64 and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260 and PI 480016 Theoretical and Applied Genetics 127:2267-2277.
ReferenceHart GE et al. (1993) Linkage maps of Triticum aestivum (hexaploid wheat, 2n = 42, genomes A, B, and D) and T. tauschii (2n = 14, genome D). Genetic maps : locus maps of complex genomes..
Data Source
Soria, Marcelo A.
Remark
Trait marker Xgwm413-1B, Xgwm273-1B, Xbarc8-1B
Nearby marker on Composite map: Xgwm413, Xgwm273, Xwmc406
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS413
Locus
Xgwm413-1B
[ Show all 9 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)18
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCTTGTCTAGATTGCTTGGG 3'
5' GATCGTCTCGTCCTTGGCA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS413
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Yr15 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr15
Reference
ReferenceDubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stripe Rust Resistance. Yr15 MAS Wheat. Marker Assisted Selection in Wheat.
URL
Protocol for Yr15 at MASwheat
QTL
QTL2084_1B-Yaniv_et_al._2015
Chromosome
1B
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Chromosome Arm
1BS
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Germplasm
Hexaploid stockPI640426
[ Show all 9 ]
Comment
Hexaploid stocks: derivatives of T. dicoccoides G-25 (300, 320).
2 Point Data
Yr15/Xcdo1173
Yr15/Xgwm264
Yr15/Xgwm273
Yr15/Xgwm413
Yr15/Xtri
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24