Query (optional)   in Class  

GrainGenes Marker Report: Yr17/Lr37/Sr38

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr17/Lr37/Sr38
Type
Trait
Chromosome
2A
Chromosome Arm
2A
Map
Wheat-Composite2004-2A0
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
cMWG682
Associated Gene
Lr37 (Triticum)
Sr38 (Triticum)
Yr17 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reaction to Puccinia recondita Rob. ex Desm.
Reaction to Puccinia striiformis Westend.
Data Source
Soria, Marcelo A.
Remark
Trait marker Xcmwg682-2A
Nearby marker on Composite map: Xcmwg682a
Position on Composite map estimated by GrainGenes.



Probe for Locus
cMWG682
Locus
cMWG682
[ Show all 11 ]
Synonym
SynonymHAR35_1246
HAR35_1247
HAR35_34385
Reference
ReferenceSayed-Tabatabaei BE et al. (1998) DNA sequencing and primer designing for RFLP clones evenly distributed in the barley genome. Barley Genetics Newsletter 28:15-18.
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
cDNA
STS
STS primers
T7 side (5' to 3') GCTCACTGCTTCGGAAAACAACGAC
T3 side (5' to 3') ATAGCACCTCCAAAATAAGAGCCTT
Sequence
AJ234421
cMWG682
CMWG682-5
Linkage Group
2
DNA Library
cMWG
Source Species
Hordeum vulgare
Source Tissue
Leaf
Insert Size
0.8
Clone Vector
Bluescript
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Stein, Nils2006.10
Kleinhofs, Andris96.05.08



Gene Associated with Locus
Lr37 (Triticum)
Gene Class
Reaction to Puccinia recondita Rob. ex Desm.
Locus
Yr17/Lr37/Sr38
Reference
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Chromosome
2A
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm
2AS
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm
Hexaploid stockAnza Lr37 Yr17 Sr38
[ Show all 6 ]
Comment
Derived from T. ventricosa. Lr37 can be recognized in seedlings at low temperatures (17C) and is effective in adult plants under field conditions. See also Sr38 and Sr17.
Hexaploid stocks: VPM1 derivatives (660).
Wheat Gene Catalog Reference
660
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24



Gene Associated with Locus
Sr38 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Locus
Sr38
Yr17/Lr37/Sr38
Reference
ReferenceTanguy A-M et al. (2005) Structure of Aegilops ventricosa chromosome 6Nv, the donor of wheat genes Yr17, Lr37, Sr38, and Cre5 Genome 48:541-546.
[ Show all 7 ]
Chromosome
2A
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm
2AS
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm
Hexaploid stockAnza Lr37 Yr17 Sr38
VPM1
Comment
Derived from Ae. ventricosa.
Near-isogenic stocks and hexaploid stocks: see Lr37. RL6081 carries additional genes from Thatcher.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24



Gene Associated with Locus
Yr17 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr17
Yr17/Lr37/Sr38
Reference
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome
2A
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Chromosome Arm
2AS
ReferenceBariana HS and McIntosh RA (1993) Cytogenetic studies in wheat XV. Location of rust resistance genes in VPM1 and their genetic linkage with other disease resistance genes in chromosome 2A Genome 36:476-482.
Germplasm
Hexaploid stockAnza Lr37 Yr17 Sr38
Comment
Hexaploid stocks: See Lr37 and Sr38. RL6081 probably carries Yr7.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24