Query (optional)   in Class  

GrainGenes Marker Report: Yr18

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr18
Type
Trait
Chromosome
7D
Chromosome Arm
7DS
Map
Wheat, Yr genes and QTL 7D26.1
Wheat-Composite2004-7D65
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
2 Point Data
Lr34/Yr18#1Distance: 0 cM
Ltn/Yr18#1Distance: 0.013 cM
Species
Triticum aestivum
Probe
WMS295
Associated Gene
Yr18 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceSpielmeyer W et al. (2005) Powdery mildew resistance and Lr34/Yr18 genes for durable resistance to leaf and stripe rust cosegregate at a locus on the short arm of chromosome 7D of wheat Theoretical and Applied Genetics 111:731-735.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm295-7D
Nearby marker on Composite map: Xgwm295
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS295
Locus
Xgwm295-7D
Yr18
Xgwm295
gwm295
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (GA)25
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GTGAAGCAGACCCACAACAC 3'
5' GACGGCTGCGACGTAGAG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS295
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Yr18 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr18
Reference
ReferenceSpielmeyer W et al. (2005) Powdery mildew resistance and Lr34/Yr18 genes for durable resistance to leaf and stripe rust cosegregate at a locus on the short arm of chromosome 7D of wheat Theoretical and Applied Genetics 111:731-735.
ReferenceSingh RP (1992) Genetic association of leaf rust resistance gene Lr34 with adult plant resistance to stripe rust in bread wheat. Phytopathology 82:835-838.
ReferenceSingh RP (1992) Association between gene Lr34 for leaf rust resistance and leaf tip necrosis in wheat. Crop Science 32:874-878.
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Chromosome
7D
ReferenceSingh RP (1992) Genetic association of leaf rust resistance gene Lr34 with adult plant resistance to stripe rust in bread wheat. Phytopathology 82:835-838.
Germplasm
Hexaploid stockJupateco 73R
Comment
Near-isogenic stocks: Thatcher near-isogenic stocks with Lr34, including the 13 two-gene combinations reported in 302 (660).
Present in hexaploid wheats with Lr34.
Lr34/Yr18 is also closely associated with Ltn, a gene for leaf tip necrosis (978).
Image
Interval maps for stripe rust resistance on chromosomes 3B, 3D, 4D, and 7D
Wheat Gene Catalog Reference
978
ReferenceSingh RP (1992) Association between gene Lr34 for leaf rust resistance and leaf tip necrosis in wheat. Crop Science 32:874-878.
660
ReferenceMcIntosh RA WGS-95-1333-Ref#660.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24