Query (optional)   in Class  

GrainGenes Marker Report: Yr24

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr24
Type
Gene
Trait
Chromosome
1B
Map
Wheat, Yr genes and QTL 1B39
Wheat-Composite2004-1B61
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Species
Triticum aestivum
Probe
BARC187
Associated Gene
Yr24 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceCheng P et al. (2014) Molecular mapping of genes Yr64 and Yr65 for stripe rust resistance in hexaploid derivatives of durum wheat accessions PI 331260 and PI 480016 Theoretical and Applied Genetics 127:2267-2277.
ReferenceLi GQ et al. (2006) Molecular mapping of stripe rust resistance gene YrCH42 in Chinese wheat cultivar Chuanmai 42 and its allelism with Yr24 and Yr26. Theoretical and Applied Genetics 112:1434.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xbarc187-1B
Nearby marker on Composite map: Xbarc187
Position on Composite map estimated by GrainGenes.



Probe for Locus
BARC187
Locus
Xbarc187
Xbarc187-1B
Yr24
barc187
barc187-1B
General Remarks
Contains motif : (CT)26
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GTGGTATTTCAGGTGGAGTTGTTTTA 3'
5' CGGAGGAGCAGTAAGGAAGG 3'
Amplification Conditions
Annealing temperature = 55
Sequence
BV211754
Source Species
Triticum aestivum
Data Source
Ward, Rick



Gene Associated with Locus
Yr24 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr24
Reference
ReferenceLi GQ et al. (2006) Molecular mapping of stripe rust resistance gene YrCH42 in Chinese wheat cultivar Chuanmai 42 and its allelism with Yr24 and Yr26. Theoretical and Applied Genetics 112:1434.
Chromosome
1B