Query (optional)   in Class  

GrainGenes Marker Report: Yr36

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr36
Type
Trait
Chromosome
6B
Chromosome Arm
6BS
Map
Wheat, Yr genes and QTL 6B23.1
Wheat-Composite2004-6B123
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Species
Triticum aestivum
Probe
BARC101
Associated Gene
Yr36 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceUauy C et al. (2005) High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus Gpc-B1 Theoretical and Applied Genetics 112:97-105.
Data Source
Matthews, David E.
Remark
Trait marker Xbarc101-6B
Nearby marker on Composite map: Xgwm88
Position on Composite map estimated by GrainGenes.



Probe for Locus
BARC101
Locus
Xbarc101a-2B
[ Show all 13 ]
General Remarks
Contains motif : (TAA)9
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' GCTCCTCTCACGATCACGCAAAG 3'
5' GCGAGTCGATCACACTATGAGCCAATG 3'
Amplification Conditions
Annealing temperature = 52
Sequence
BV211583
Source Species
Triticum aestivum
Data Source
Ward, Rick



Gene Associated with Locus
Yr36 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Pathology
Stripe Rust
Locus
Yr36
Reference
ReferenceUauy C et al. (2005) High-temperature adult-plant (HTAP) stripe rust resistance gene Yr36 from Triticum turgidum ssp. dicoccoides is closely linked to the grain protein content locus Gpc-B1 Theoretical and Applied Genetics 112:97-105.
URL
Protocol for Yr36 at MASwheat
QTL
QTL2071_6B-Uauy_et_al._2005
Comment
High-temperature adult plant resistance