Query (optional)   in Class  

GrainGenes Marker Report: Yr5

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr5
Type
Gene
Trait
Chromosome
2B
Chromosome Arm
2B
2BL
Map
Triticum-Genes-2B15
Wheat, Yr genes and QTL 2B62.1
Wheat-Composite2004-2B87
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat, Yr genes and QTL
2 Point Data
Centromere/Yr5#1Distance: 21 cM
Yr7/Yr5#1Distance: 0 cM
Yr7/Yr5#2
Species
Triticum aestivum
Probe
WMS501
Associated Gene
Yr5 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceSun Q et al. (2002) Microsatellite marker for yellow rust resistance gene Yr5 in wheat introgressed from spelt wheat Plant Breeding 121:539-541.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm501-2B
Nearby marker on Composite map: Xgwm501
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS501
Locus
Xgwm501-2B
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)33
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GGCTATCTCTGGCGCTAAAA 3'
5' TCCACAAACAAGTAGCGCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS501
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Yr5 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr5
Reference
ReferenceSun Q et al. (2002) Microsatellite marker for yellow rust resistance gene Yr5 in wheat introgressed from spelt wheat Plant Breeding 121:539-541.
ReferenceMacer RCF (1966) The formal and monosomic genetic analysis of stripe rust (Puccinia striiformis) resistance in wheat. Proceedings of the 2nd International Wheat Genetics Symposium, Hereditas Supplement, Lund, Sweden 2:127-142.
ReferenceDubcovsky J MAS Wheat. Bringing Genomics to the Wheat Fields/ Disease resistance. Stripe Rust Resistance. Yr5 MAS Wheat. Marker Assisted Selection in Wheat.
URL
Protocol for Yr5 at MASwheat
Chromosome
2B
Chromosome Arm
2BL
Germplasm
Hexaploid stockE5557
ReferencePBA-41-935 Plant Breeding Abstracts 41:935.
[ Show all 8 ]
Comment
Hexaploid stocks: T. spelta album (627). Seven spelt accessions from Europe and Iran (458).
Wheat Gene Catalog Reference
627
ReferenceMacer RCF (1966) The formal and monosomic genetic analysis of stripe rust (Puccinia striiformis) resistance in wheat. Proceedings of the 2nd International Wheat Genetics Symposium, Hereditas Supplement, Lund, Sweden 2:127-142.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24