Query (optional)   in Class  

GrainGenes Marker Report: Yr7

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr7
Type
Gene
Trait
Chromosome
2B
Chromosome Arm
2BL
Map
Triticum-Genes-2B15
Wheat-Composite2004-2B94
[ Show Nearby Loci ]
QTL with Locus Marker
Qtcr.ipk-2B.3
Map Data
Wheat genes
2 Point Data
Sr9g/Yr7#1Distance: 1.6 cM
Yr7/Dfq1#1Distance: 6 cM
Yr7/Yr5#1Distance: 0 cM
Yr7/Yr5#2
Species
Triticum aestivum
Probe
WMS526
Associated Gene
Yr7 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceYao ZJ et al. (2006) The molecular tagging of the yellow rust resistance gene Yr7 in wheat transferred from differential host Lee using microsatellite markers. Scientia Agricultura Sinica 39:1146-1152.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm526-2B
Nearby marker on Composite map: Xgwm526
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS526
Locus
Xgwm526
[ Show all 13 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)16
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CAATAGTTCTGTGAGAGCTGCG 3'
5' CCAACCCAAATACACATTCTCA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS526
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Yr7 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Locus
Yr7
Reference
ReferenceMcIntosh RA et al. (1981) Cytogenetical studies in wheat. XI. Sr9g for reaction to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 87:274-289.
ReferenceMacer RCF (1966) The formal and monosomic genetic analysis of stripe rust (Puccinia striiformis) resistance in wheat. Proceedings of the 2nd International Wheat Genetics Symposium, Hereditas Supplement, Lund, Sweden 2:127-142.
Chromosome
2B
ReferenceJohnson R et al. (1969) PBI-69-113 Annual Report, Plant Breeding Institute Cambridge 113-123.
ReferenceStubbs RW (1966) Recent aspects of the physiological specialisation of yellow rust in the Netherlands Proceedings Third European Yellow Rust Conference, Cambridge, UK, 1964 47-54.
Chromosome Arm
2BL
ReferenceMcIntosh RA et al. (1981) Cytogenetical studies in wheat. XI. Sr9g for reaction to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 87:274-289.
Germplasm
Hexaploid stockBROCK
ReferenceBayles RA and Thomas JE (1984) Yellow rust of wheat.. U.K. Cereal Pathogen Virulence Survey, 1983 Annual Report, National Institute Agricultural Botany 23-31.
[ Show all 19 ]
Comment
Hexaploid stocks: Present in many hexaploid wheats with Sr9g; see 687.
Tetraploid stocks: Not present in Acme or Kubanka (687).
Wheat Gene Catalog Reference
687
ReferenceMcIntosh RA et al. (1981) Cytogenetical studies in wheat. XI. Sr9g for reaction to Puccinia graminis tritici. Zeitschrift fur Pflanzenzuchtung 87:274-289.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24