Query (optional)   in Class  

GrainGenes Marker Report: Yr9

[ Printable Version ]  [ Submit comment/correction ]

Locus
Yr9
Type
Trait
Chromosome
1B
Chromosome Arm
1BL
Map
Wheat, Yr genes and QTL 1B1.7
Wheat-Composite2004-1B46
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Species
Triticum aestivum
Probe
WMS582
Associated Gene
Yr9 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceWeng DX et al. (2005) Microsatellite marker kinked with stripe rust resistant gene Yr9 in wheat. Acta Genetica Sinica 32:937-941.
ReferenceLukaszewski AJ (2000) Manipulation of the 1RS.1BL translocation in wheat by induced homoeologous recombination Crop Science 40:216-225.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm582-1B
Nearby marker on Composite map: Xgwm582
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS582
Locus
Xgwm582-1B
[ Show all 8 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)27imp(TA)6
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' AAGCACTACGAAAATATGAC 3'
5' TCTTAAGGGGTGTTATCATA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS582
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
Yr9 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Pathology
Stripe Rust
Locus
Yr9
Yr9^A^
Reference
ReferenceLukaszewski AJ (2000) Manipulation of the 1RS.1BL translocation in wheat by induced homoeologous recombination Crop Science 40:216-225.
[ Show all 10 ]
Chromosome
1B
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
1R
ReferenceMettin D et al. (1973) Additional evidence on spontaneous 1B/1R wheat rye substitutions and translocations. Proceedings of the 4th International Wheat Genetics Symposium 179-184.
ReferenceZeller FJ (1973) lB/lR wheat-rye substitutions and translocations Proceedings of the 4th International Wheat Genetics Symposium 209-221.
Germplasm
Hexaploid stockALMUS
ReferenceMettin D et al. (1978) Studies on the nature and the possible origin of the spontaneously translocated 1B-1R chromosome in wheat. Wheat Information Service 47:12-16.
[ Show all 37 ]
Comment
Derived from S. cereale.
Hexaploid stocks: present in either 1R(1B) [Burgas 2, Clement, Lovrin 13, Mildress, Mironovskaja 10, Neuzucht, Orlando, Roseana, Saladin, Salzmuner Bartweizen, Sarhad 82, St 14/44, Weique, Wentzel W, Winnetou, Zorba] or T1BL.1RS [Almus, Aurora, Benno, Bezostaya II, Clement, Kavkaz, Lovrin 10, Lovrin 12, Mildress, Perseus, Predgornaya, Salmon, Skorospelka 35, Veery, Weique, Winnetou, Riebesel 47/51, St 2153/63, Weihenstephan, Pakistan 81] .
Hexaploid stocks: chromosome status not specified; Agra (43, 58); Baron (65); Branka (58); Danubia (53); Hammer (65); Iris (53); Kromerzhizhskaya (817); Lyutestsens 15 (817); Roxana (53); Sabina (53); Selekta (53); Shtorm (817); Solaris (53); Stuart (65); Stetson (65); Nautica (1031); Sparta (58); Donata (1031).
Hexaploid stock: Weique is heterogeneous (1191).
Hexaploid stocks: Reference 708 reported that Yr9 is present in Mildress in 1R substituted for 1B and in Winnetou in T1BL.1RS while reference 731 reported that the gene is present in Mildress in T1BL.1RS and in Winnetou in 1R substituted for 1B.
Image
C-bands for Lr26/Sr31/Yr9/Pm8
Wheat Gene Catalog Reference
58
ReferenceBartos P and Valkoun J (1988) Rust resistance genes in Czechoslovak wheats. Cereal Rusts and Powdery Mildews Bulletin 16:36-40.
[ Show all 8 ]
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24