Query (optional)   in Class  

GrainGenes Marker Report: YrCN19

[ Printable Version ]  [ Submit comment/correction ]

Locus
YrCN19
Type
Trait
Chromosome
2B
Chromosome Arm
2BS
Map
Wheat-Composite2004-2B60
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS410
Associated Gene
YrCN19 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceLuo PG et al. (2005) Identification, chromosome location, and diagnostic markers for a new gene (YrCN19) for resistance to wheat stripe rust. Phytopathology 95:1266-1270.
Data Source
Wheat Gene Catalogue
Remark
Trait marker Xgwm410-2BS
Nearby marker on Composite map: Xgwm410.2
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS410
Locus
Xgwm410
[ Show all 12 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CA)11(CA)10(CA)8
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' GCTTGAGACCGGCACAGT 3'
5' CGAGACCTTGAGGGTCTAGA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS410
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Gene Associated with Locus
YrCN19 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Pathology
Stripe Rust
Locus
YrCN19
Reference
ReferenceLuo PG et al. (2005) Identification, chromosome location, and diagnostic markers for a new gene (YrCN19) for resistance to wheat stripe rust. Phytopathology 95:1266-1270.