Query (optional)   in Class  

GrainGenes Probe Report: CFD15

[ Submit comment/correction ]

Probe
CFD15  [ Marker Report ]
Locus
Xcfd15-1A
[ Show all 11 ]
Reference
ReferenceGuyomarc'h H et al. (2002) Characterisation of polymorphic microsatellite markers from Aegilops tauschii and transferability to the D-genome of bread wheat Theoretical and Applied Genetics 104:1164-1172.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CT)20(TGTA)3
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CTCCCGTATTGAGCAGGAAG 3'
Reverse 5' GGCAGGTGTGGTGATGATCT 3'
SSR size
179
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
1A/1D
Source Species
Aegilops tauschii
Data Source
Sourdille, Pierre

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.