Query (optional)   in Class  

GrainGenes Probe Report: rast1-4

[ Printable Version ]  [ Submit comment/correction ]

Probe
rast1-4  [ Marker Report ]
Locus
rast1_4
Reference
ReferencePortyanko VA et al. (2001) A linkage map of hexaploid oat based on grass anchor DNA clones and its relationship to other oat maps Genome 44:249-265.
General Remarks
Targets SSR region of a thaumatin-like pathogenesis-related protein
Type
SSR
PCR primers
5' CTTCTGCCCATGAAACCCTA
5' GAGGGTGCATGTGCTGAGT
Sequence
L39777
Source Gene Class
Pathogenesis-related protein
Source Gene
Rast1-4 (Avena)
Source Species
Avena sativa