Query (optional)   in Class  

GrainGenes Probe Report: 1fehw3

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.


Probe
1fehw3
Locus
1-feh-w3
Reference
ReferenceMohamed EA et al. (2023) Screening Spring Wheat Genotypes for TaDreb-B1 and Fehw3 Genes under Severe Drought Stress at the Germination Stage Using KASP Technology Genes 14.
ReferenceUr Rehman S et al. (2021) Development and Exploitation of KASP Assays for Genes Underpinning Drought Tolerance Among Wheat Cultivars From Pakistan. Frontiers in Genetics 12.
ReferenceRasheed A et al. (2016) Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theoretical and Applied Genetics 129:1843-60.
General Remarks
FAM = Westonia type
HEX = Kauz type
Type
KASP
PCR primers
FAM 5' CTCCCCCCTTCCTTCTGTCC
[ Show all 6 ]
Source Gene
1-feh-w3 (Triticum)
Source Species
Triticum aestivum

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.