Query (optional)   in Class  

GrainGenes Probe Report: 84c21j33

[ Printable Version ]  [ Submit comment/correction ]

Probe
84c21j33  [ Marker Report ]
Locus
BAC84c21_s33
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceCardle L et al. (2000) Computational and experimental characterization of physically clustered simple sequence repeats in plants Genetics 156:847-854.
Type
SSR
PCR primers
AATCCCTCTTCATAAATTAGTG
TCCAAATCACTGAACAAAAAC