Query (optional)   in Class  

GrainGenes Probe Report: AB009307

[ Printable Version ]  [ Submit comment/correction ]

Probe
AB009307  [ Marker Report ]
Locus
AB009307
Similar Probes
{SpCl-1c}
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceKantety RV et al. (2002) Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat Plant Molecular Biology 48:501-510.
General Remarks
Motif acat, length 28 bp
Type
SSR
EST
PCR primers
Forward TTGTGCATATGTTGATGTGA
Reverse CGGTACCAATTCTTTGATTAC
Sequence
AB009307
Source Species
Hordeum vulgare
Data Source
Kantety, Ramesh V.2002.05