Query (optional)   in Class  

GrainGenes Probe Report: ABA1

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABA1  [ Marker Report ]
Locus
ABA1
ABA001
Type
cDNA
PCR
STS
PCR primers
CACGCCCTCGCCAACGCTCTCCA
GGGGAGATATCGACCAAAGT
Source Species
Hordeum vulgare
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Kleinhofs, Andris92.09
Blake, Tom95.08.24