Query (optional)   in Class  

GrainGenes Probe Report: ABC00177_L02R02

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC00177_L02R02  [ Marker Report ]
Locus
scsnp00177
Data at Germinate
ABC00177
Data at PLEXdb
Barley1_00177
General Remarks
Estimated product size = unknown
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc00177
Type
STS
PCR primers
5' AATCTGCTCATCCCATCTGC
5' GTTCAGGCAATGCAGCATAA
Sequence
Barley1_00177
Source Species
Hordeum vulgare
Data Source
Russell, Joanne