Query (optional)   in Class  

GrainGenes Probe Report: ABC00460_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC00460_L01R01  [ Marker Report ]
Locus
scsnp00460
Data at Germinate
ABC00460
Data at PLEXdb
Barley1_00460
General Remarks
Estimated product size = 98
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc00460
Type
STS
PCR primers
5' TTGAAGACATCCTCCGTGCT
5' CCCGAATGTAGTCCCAGACA
Sequence
Barley1_00460
Source Species
Hordeum vulgare
Data Source
Russell, Joanne