Query (optional)   in Class  

GrainGenes Probe Report: ABC00703_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC00703_L01R01  [ Marker Report ]
Locus
scsnp00703
Data at Germinate
ABC00703
General Remarks
Estimated product size = unknown
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc00703
Type
STS
PCR primers
5' TGGCTATGCTTTTGGTAGACG
5' CTCAGGTCCAAACCCAAGAA
Source Species
Hordeum vulgare
Data Source
Russell, Joanne