Query (optional)   in Class  

GrainGenes Probe Report: ABC00940_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC00940_L01R01  [ Marker Report ]
Locus
scsnp00940
Data at Germinate
ABC00940
Data at PLEXdb
Barley1_00940
General Remarks
Estimated product size = 181
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc00940
Type
STS
PCR primers
5' GAGGTTCGATATCCGAAGGA
5' ACCCTCGGCACTTACAAGG
Sequence
Barley1_00940
Source Species
Hordeum vulgare
Data Source
Russell, Joanne