Query (optional)   in Class  

GrainGenes Probe Report: ABC01216_L02R02

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC01216_L02R02  [ Marker Report ]
Locus
scsnp01216
Data at Germinate
ABC01216
Data at PLEXdb
Barley1_01216
General Remarks
Estimated product size = 228
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc01216
Type
STS
PCR primers
5' CCCCATCCATCAGACAAGAG
5' ACTGCACCTTGTAGCCGATG
Sequence
Barley1_01216
Source Species
Hordeum vulgare
Data Source
Russell, Joanne