Query (optional)   in Class  

GrainGenes Probe Report: ABC01648_L02R02

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC01648_L02R02  [ Marker Report ]
Locus
scsnp01648
Data at Germinate
ABC01648
Data at PLEXdb
Barley1_01648
General Remarks
Estimated product size = unk
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc01648
Type
STS
PCR primers
5' AGAGCAATGGTGACGCTCTT
5' ATCAAGAGGGCGATCAAGAA
Sequence
Barley1_01648
Source Species
Hordeum vulgare
Data Source
Russell, Joanne