Query (optional)   in Class  

GrainGenes Probe Report: ABC01719

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC01719  [ Marker Report ]
Locus
scsnp01797
Reference
ReferenceAbu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
PCR primers
GGAGACCTCCATCTTCGCCA
GGCAGCGGAAAAACAACAGC