Query (optional)   in Class  

GrainGenes Probe Report: ABC02109_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC02109_L01R01  [ Marker Report ]
Locus
scsnp02109
Data at Germinate
ABC02109
Data at PLEXdb
Barley1_02109
General Remarks
Estimated product size = 175
BarleySNP type = SNP From EST
Technology platform used = PyrosequencingTM Technology
Affymetrix contig name = abc02109
Type
STS
PCR primers
5' CTATAAATGGGCAGCGGAAG
5' CACGGCGACATGGATTTATT
Sequence
Barley1_02109
Source Species
Hordeum vulgare
Data Source
Russell, Joanne