Query (optional)   in Class  

GrainGenes Probe Report: ABC03381_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC03381_L01R01  [ Marker Report ]
Locus
scssr03381
Data at Germinate
ABC03381
Data at PLEXdb
Barley1_03381
General Remarks
Estimated product size = 162
BarleySNP type = Contig Indel
Technology platform used = Radioisotope Labelled PCR Separation
Affymetrix contig name = abc03381
PCR primers
5' CAGGGACGTACAATATTACCG
5' AATAAGCAGGGTACCTTTTGG
Sequence
Barley1_03381
Source Species
Hordeum vulgare
Data Source
Russell, Joanne