Query (optional)   in Class  

GrainGenes Probe Report: ABC07106_L01R01

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC07106_L01R01  [ Marker Report ]
Locus
scssr07106
Data at Germinate
ABC07106
Data at PLEXdb
Barley1_07106
General Remarks
Estimated product size = unknown
BarleySNP type = Contig Indel
Technology platform used = Radioisotope Labelled PCR Separation
Affymetrix contig name = abc07106
PCR primers
5' GCGCTGTCTCTTCTATGTGC
5' AGGTGCTCCTAATCTGATGG
Sequence
Barley1_07106
Source Species
Hordeum vulgare
Data Source
Russell, Joanne