Query (optional)   in Class  

GrainGenes Probe Report: ABC163

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC163  [ Marker Report ]
Locus
ABC163B
[ Show all 7 ]
Synonym
SynonymHAR35_15282
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
STS primers
5' TTACGGGATCAAAGCTGAGGC
5' TGGCAGCGCTGTTGTAGGTT
STS size
252
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BQ548055
ABC163-5
Linkage Group
Group 6
Source Species
Hordeum vulgare
Insert Size
0.3
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03