Query (optional)   in Class  

GrainGenes Probe Report: ABC165

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC165  [ Marker Report ]
Locus
ABC165
ABC165C
ABC165D
ABC165A
ABC165-2H
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
CAATGACTTCAAGGGGTCTG
TCCATACCATTCCCATCTAA
Sequence
L43932
Linkage Group
Group 2
2
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.5
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Hayes, Patrick M.
Data Source
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08