Query (optional)   in Class  

GrainGenes Probe Report: ABC168

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC168  [ Marker Report ]
Locus
ABC168
HD021C10
Synonym
SynonymHAR35_5989
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GTA AGA ACA AAA CCC AAA AC
GGA GAC CCA GCG GAA GGA GA
STS primers
5' CCCGGTAACTACTTACACCG
5' CGTGGAGCTGGTGTGCGAGA
STS size
223
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
L43935
ABC168
ABC168-5
Linkage Group
Group 7
Source Species
Hordeum vulgare
Insert Size
0.2
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
Kleinhofs, Andris
Clone Authority
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03