Query (optional)   in Class  

GrainGenes Probe Report: ABC261

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC261  [ Marker Report ]
Locus
ABC261
HI057G22
HD008L1
Xabc261
ABC261-1H
External Databases
DDBJ
EMBL
GenBank
Type
cDNA
STS
PCR primers
AGGAAGCTCAAGAAGGTGAA
AAAGTCAAGAGTTGCATCAA
Sequence
L43942
ABC261
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24