Query (optional)   in Class  

GrainGenes Probe Report: ABC322

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABC322  [ Marker Report ]
Locus
ABC322B
HD084P24
ABC322A
Synonym
SynonymHAR35_8900
External Databases
DDBJ
EMBL
GenBank
Type
STS
PCR primers
ACATTGTTCAGTGCTGATTC
ATCAGGCTGGTATCTGTTTC
Sequence
L43950
ABC322
Polymorphism
ABC322 EcoRI
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Image
ABC322 BROWSSM autoradiogram
Data Source
Blake, Tom95.08.24