Query (optional)   in Class  

GrainGenes Probe Report: ABG20

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG20  [ Marker Report ]
Locus
ABG20
[ Show all 13 ]
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
STS primers
5' GGCAACCGCAAGAAAGAAAG
5' CCTCTCATGTCAGAGCATTT
STS size
254
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
L43971
ABG20
ABG20-5
ABG20-3
Linkage Group
Group 6
Source Species
Hordeum vulgare
Insert Size
1.3
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03