Query (optional)   in Class  

GrainGenes Probe Report: ABG316

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG316  [ Marker Report ]
Locus
ABG316f
[ Show all 8 ]
Synonym
Please seep13XB(1.1)
SynonymHAR35_31000
External Databases
DDBJ
EMBL
GenBank
General Remarks
The 2.4 kb fragment from this clone is ABG319.
Type
Genomic
STS
PCR primers
CCAATTGTGTGAATGGATGT
CGTAAGAAGGAGAAGATGAC
Sequence
L43975
ABG316
Linkage Group
3
Barley 7 (5H)
2
Source Species
Hordeum vulgare
Insert Size
1.1
1
Clone Vector
pUC
Excision Enzyme
EcoRI
HindIII
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Kilian, Andrzej
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
Kleinhofs, Andris96.05.08