Query (optional)   in Class  

GrainGenes Probe Report: ABG320

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG320  [ Marker Report ]
Locus
ABG320
Xabg320-4B
Xabg320-5D
ABG320-7H
External Databases
DDBJ
EMBL
GenBank
Type
Genomic
STS
PCR primers
GATCCAACAGCAAGGAAAGA
AGACGAGTGGACACATGATG
Sequence
L43979
ABG320
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Clone Authority
Blake, Tom
Data Source
Blake, Tom95.08.24