Query (optional)   in Class  

GrainGenes Probe Report: ABG377

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG377  [ Marker Report ]
Locus
ABG377
Xabg377-3
Xabg377
ABG377-3H
Synonym
SynonymHAR35_10264
HAR35_35535
External Databases
DDBJ
EMBL
GenBank
Reference
ReferenceKleinhofs A et al. (1993) A molecular, isozyme and morphological map of the barley (Hordeum vulgare) genome Theoretical and Applied Genetics 86:705-712.
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
GTG TTA CAG CCA CCT ATT TC
GCT GCT ATG AGG AGA GAA CC
STS primers
5' CAGAGTTGTTAGGCCTGGAA
5' GACTCTTGGCCCTGCTCCAT
STS size
229
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
L43984
ABG377
ABG377-5
Linkage Group
3L
3
Source Species
Hordeum vulgare
Source Germplasm
Shin Ebisu 16
Insert Size
0.7
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Lapitan, Nora
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03