Query (optional)   in Class  

GrainGenes Probe Report: ABG387

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG387  [ Marker Report ]
Locus
ABG387a
[ Show all 15 ]
Synonym
SynonymHAR35_1739
Type
Genomic
STS
STS primers
5' GCACTGGCATAGTCTCACAA
5' CGATGCTGGTTCGGTCATAC
STS size
198
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
BH854352
ABG387-5
Source Species
Hordeum vulgare
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03