Query (optional)   in Class  

GrainGenes Probe Report: ABG458

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG458  [ Marker Report ]
Locus
ABG458
[ Show all 6 ]
Reference
ReferenceAbu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270.
ReferenceKunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks
Restriction enzyme informative in CAP analysis is RsaI
Shin Ebisu16 gDNA
Type
Genomic
STS
STS primers
5' GAGAGCCGATGACGGTATGT
5' CTTGGACACATGCCATATCC
STS size
248
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
L43996
ABG458
ABG458-5
Linkage Group
6S
Source Species
Hordeum vulgare
Insert Size
0.4
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03