Query (optional)   in Class  

GrainGenes Probe Report: ABG460

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG460  [ Marker Report ]
Locus
Xabg460-3
[ Show all 9 ]
Synonym
SynonymHAR35_23373
HAR35_30482
External Databases
DDBJ
EMBL
GenBank
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
TTG TGT GGT AAA AGT AAA AT
TGG AGG AGA GCG GAA GAG AT
STS primers
5' CAGCGATTACAAGCGTGTAA
5' GGGACGTTCAAATTAACTTG
STS size
380
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
L44023
ABG460
ABG460-5
ABG460-3
Polymorphism
ABG460 EcoRV
Linkage Group
3S
Source Species
Hordeum vulgare
Insert Size
1.6
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Image
ABG460 SO autoradiogram
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03