Query (optional)   in Class  

GrainGenes Probe Report: ABG461

[ Printable Version ]  [ Submit comment/correction ]

Probe
ABG461  [ Marker Report ]
Locus
ABG461C
[ Show all 9 ]
Synonym
SynonymHAR35_21952
HAR35_3657
External Databases
DDBJ
EMBL
GenBank
General Remarks
Shin Ebisu16 gDNA
Type
Genomic
STS
PCR primers
TAG AAG TAG AAA AAG GAA CC
GAA GAA CAA CCA ATA GAA TG
STS primers
5' AGTTCAATGTTCACCACAGC
5' CAATGTACCGGACTATTTGG
STS size
283
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
L44024
ABG461
ABG461-5
ABG461-3
Linkage Group
Group 1
Source Species
Hordeum vulgare
Insert Size
1
Clone Vector
pGEM
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Kleinhofs, Andris
Blake, Tom
Data Source
Graner, Andreas94.03.08
Blake, Tom95.08.24
ATMI92.09
Kuenzel, Gottfried00.03